The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1833
Genome IDAE009950
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus furiosus DSM 3638 [AE009950]
Start position on genome 830257
End posion on genome 830333
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
catcgagggt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCAAGGCGGAGGCCGCGGGTTCAAA
TCCCGCCCGGTCCACCA
Downstream region at tRNA end position
aattcttctt
Secondary structure (Cloverleaf model)
>At1833	Ala	CGC
                   t      ACCA aattcttctt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G A A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCAAGGCGGAGGCCGCGGGTTCAAA
TCCCGCCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK