The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1839
Genome IDAE009950
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus furiosus DSM 3638 [AE009950]
Start position on genome 1291820
End posion on genome 1291906
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
atttaattgt
tRNA gene sequence
GCCGGGGTAGCCTAGCCAGGGAAGGCGCGGGCCTGGAGAGCCCGTGGGCGTTCGCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Downstream region at tRNA end position
tacttctcct
Secondary structure (Cloverleaf model)
>At1839	Ser	GGA
                   t      GCCA tacttctcct
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G C C C C     A
      C G A        A      | | | | |     A
    C       T C C G       C G G G G     C
    A       | | | |                 T T
    G       A G G C
      G G A        G     TGGGCGTTCGCCCAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTAGCCTAGCCAGGGAAGGCGCGGGCCTGGAGAGCCCGTGGGCGTTCGCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK