The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1841
Genome IDAE009950
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus furiosus DSM 3638 [AE009950]
Start position on genome 1747767
End posion on genome 1747843
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
agttatgggc
tRNA gene sequence
GGGCCCGTGGTCTAGCTGGTTATGACGCCGCCCTTACGAGGCGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA
Downstream region at tRNA end position
taaagggaac
Secondary structure (Cloverleaf model)
>At1841	Val	TAC
                   c      ACCA taaagggaac
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
      C G A        G      | | | | |     G
    T       T C T G       C G G G G     C
    G         | | |                 T T
    G       T G A C
      T T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGTCTAGCTGGTTATGACGCCGCCCTTACGAGGCGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK