The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1877
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 522870
End posion on genome 522956
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
aaaatggagc
tRNA gene sequence
GCCGGGGTAGCCTAGCCTGGGAAGGCGCGGGACTCGAGATCCCGTGGGCGTGGTCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Downstream region at tRNA end position
cctgccgagt
Secondary structure (Cloverleaf model)
>At1877	Ser	CGA
                   c      GCCA cctgccgagt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G C C C C     A
      C G A        A      | | | | |     A
    C       T C C G       C G G G G     C
    T       | | | |                 T T
    G       A G G C
      G G A        G     TGGGCGTGGTCCCAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTAGCCTAGCCTGGGAAGGCGCGGGACTCGAGATCCCGTGGGCGTGGTCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK