The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1879
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 555677
End posion on genome 555754
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
catcaggggt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGTCAGAGCACCGGGCTTTTAACCCGGTGGTCGCGGGTTCAA
ATCCCGCCCGGCCCGCCA
Downstream region at tRNA end position
agtttatttc
Secondary structure (Cloverleaf model)
>At1879	Lys	TTT
                   t      GCCA agtttatttc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     C G C C C     A
    C C G A        A      | | | | |     A
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    T C A          A     TGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGTCAGAGCACCGGGCTTTTAACCCGGTGGTCGCGGGTTCAA
ATCCCGCCCGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK