The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1884
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 1061495
End posion on genome 1061571
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
gtgtgaaggt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGGAGAGCGCCGCCCTCGCAAGGCGGAGGCCGCGGGTTCAAA
TCCCGCCCGGTCCACCA
Downstream region at tRNA end position
ccacaattct
Secondary structure (Cloverleaf model)
>At1884	Ala	CGC
                   t      ACCA ccacaattct
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G G A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGGAGAGCGCCGCCCTCGCAAGGCGGAGGCCGCGGGTTCAAA
TCCCGCCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK