The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1889
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 1615333
End posion on genome 1615409
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
atcgggaaat
tRNA gene sequence
GGGCCCGTGGTCTAGTTGGTCATGACGCCGCCCTTACGAGGCGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA
Downstream region at tRNA end position
gaagctccta
Secondary structure (Cloverleaf model)
>At1889	Val	TAC
                   t      ACCA gaagctccta
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
      T G A        G      | | | | |     G
    T       T C T G       C G G G G     C
    G         | | |                 T T
    G       T G A C
      T C A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGTCTAGTTGGTCATGACGCCGCCCTTACGAGGCGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK