The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1893
Genome IDBA000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus horikoshii OT3 [BA000001]
Start position on genome 432383
End posion on genome 432308
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
atttgggagt
tRNA gene sequence
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Downstream region at tRNA end position
aaaaccccat
Secondary structure (Cloverleaf model)
>At1893	Gln	TTG
                   t      ACCA aaaaccccat
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       T G T G       C C G G G     C
    G       + | | +                 T T
    C       G C A T
      C A A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK