The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1934
Genome IDAP006878
Search identical group
Phylum/ClassEuryarchaeota
SpeciesThermococcus kodakarensis KOD1 [AP006878]
Start position on genome 1910169
End posion on genome 1910244
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tctatcgggc
tRNA gene sequence
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Downstream region at tRNA end position
gtacagccct
Secondary structure (Cloverleaf model)
>At1934	Gln	TTG
                   c      ACCA gtacagccct
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       T G T G       C C G G G     C
    G       + | | +                 T T
    C       G C A T
      C A A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK