The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1966
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 237339
End posion on genome 237411
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tccacaatgc
tRNA gene sequence
GGGCTCGTGGTCCAGTGGTTACGACGTCGCCCTTACAAGGCGGAGATCACCGGTTCGATC
CCGGTCGGGCCCAttt
Downstream region at tRNA end position
aatctattaa
Secondary structure (Cloverleaf model)
>At1966	Val	TAC
                   c      Attt aatctattaa
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          C T
                    T     T G G C C     A
      T G A        G      | | | | |     G
    G       C C T G       A C C G G     C
    G         | | |                 T T
    T       C G A C
      T A          G     AGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCCAGTGGTTACGACGTCGCCCTTACAAGGCGGAGATCACCGGTTCGATC
CCGGTCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK