The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1968
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 413604
End posion on genome 413677
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ttctaatcat
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGTAGAGCATCTGGCTTTTAACCAGGTGGTCAGGGGTTCGAA
CCCCCTCGGGCCCGctc
Downstream region at tRNA end position
acgcgtggtg
Secondary structure (Cloverleaf model)
>At1968	Lys	TTT
                   t      Gctc acgcgtggtg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          C A
                    T     T C C C C     A
      C G A        A      | | | | |     G
    C       C T C G       A G G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        A     TGGTC
                    T + G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGTAGAGCATCTGGCTTTTAACCAGGTGGTCAGGGGTTCGAA
CCCCCTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK