The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1978
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 1185299
End posion on genome 1185383
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
gctatttaaa
tRNA gene sequence
GCTGGGATAGCCTAGCCCGGTAAGGCGCAGGTCTGGAAAACCTGTGCTCGTATAGAGCTC
GGGAGTTCAAATCTCCCTCCCAGCGctt
Downstream region at tRNA end position
ctttactgat
Secondary structure (Cloverleaf model)
>At1978	Ser	GGA
                   a      Gctt ctttactgat
                     G - C
                     C - G
                     T - A
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C C T C     A
      C G A        A      | | | | |     A
    C       T C C G       G G G A G     C
    C       | | | |                 T T
    G       A G G C
      G T A        G     TGCTCGTATAGAGCTC
                    C - G
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTGGGATAGCCTAGCCCGGTAAGGCGCAGGTCTGGAAAACCTGTGCTCGTATAGAGCTC
GGGAGTTCAAATCTCCCTCCCAGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK