The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1985
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 1533709
End posion on genome 1533781
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gatcgtgcag
tRNA gene sequence
AGCCCTGTGGTGTAGTGGACAAGCATTTTGGACTTTGGATCCAAAGACGGCAGTTCGAAT
CTGCCCAGGGCTAtac
Downstream region at tRNA end position
agtggtgaaa
Secondary structure (Cloverleaf model)
>At1985	Gln	TTG
                   g      Atac agtggtgaaa
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     C C G T C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C A G     C
    G       + | | +                 T T
    A       G C A T
      C A A        T     AGAC
                    T - A
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCTGTGGTGTAGTGGACAAGCATTTTGGACTTTGGATCCAAAGACGGCAGTTCGAAT
CTGCCCAGGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK