The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1986
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 1556308
End posion on genome 1556379
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
aatattagat
tRNA gene sequence
GGGCCGGTAGATCAGCGGTAGATCGCCTGCTTCGCAAGCAGGAGGCCTCGGGTTCAAATC
CCGACCGGTCCAtag
Downstream region at tRNA end position
ttctatgtgc
Secondary structure (Cloverleaf model)
>At1986	Ala	CGC
                   t      Atag ttctatgtgc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     A G C C C     A
        G A        A      | | | | |     A
      C     C T A G       T C G G G     C
      G     | | | |                 T T
      G     G A T C
        T A        G     AGGCC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGATCAGCGGTAGATCGCCTGCTTCGCAAGCAGGAGGCCTCGGGTTCAAATC
CCGACCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK