The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1989
Genome IDAL139299
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma acidophilum [AL139299]
Start position on genome 192481
End posion on genome 192407
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tagcctcact
tRNA gene sequence
GGGCCCGTGGCCTAGCTAGGATAAGGCACCGTCCTTCTAAGTCGGGAATCGTGGGTCCAA
ATCCCACCGGGCCCGtat
Downstream region at tRNA end position
ctttattggt
Secondary structure (Cloverleaf model)
>At1989	Arg	TCT
                   t      Gtat ctttattggt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C A C C C     A
    T C G A        G      | | | | |     A
  A         T C C G       G T G G G     C
  G         | | | |                 T C
  G         A G G C
    A T A          A     GAATC
                    C - G
                    C - G
                    G - C
                    T   T
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCCTAGCTAGGATAAGGCACCGTCCTTCTAAGTCGGGAATCGTGGGTCCAA
ATCCCACCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK