The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2028
Genome IDBA000011
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma volcanium GSS1 [BA000011]
Start position on genome 84957
End posion on genome 84885
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
cttgtatgct
tRNA gene sequence
AGCCCTGTGGTGTAGTGGACAAGCATTTTGGACTTTGGATCCAACGACGGCAGTTCGAAT
CTGCCCAGGGCTAtaa
Downstream region at tRNA end position
agcggtgaac
Secondary structure (Cloverleaf model)
>At2028	Gln	TTG
                   t      Ataa agcggtgaac
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     C C G T C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C A G     C
    G       + | | +                 T T
    A       G C A T
      C A A        T     CGAC
                    T - A
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCTGTGGTGTAGTGGACAAGCATTTTGGACTTTGGATCCAACGACGGCAGTTCGAAT
CTGCCCAGGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK