The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2038
Genome IDBA000011
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma volcanium GSS1 [BA000011]
Start position on genome 436949
End posion on genome 436866
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
tgggtctatt
tRNA gene sequence
GCTGGGATAGCCTAGCCTGGTAAGGCGCAGGTCTGGAAAACCTGTGCTCATTAGAGCTCG
GGAGTTCAAATCTCCCTCCCAGCGcct
Downstream region at tRNA end position
gaaaatacac
Secondary structure (Cloverleaf model)
>At2038	Ser	GGA
                   t      Gcct gaaaatacac
                     G - C
                     C - G
                     T - A
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C C T C     A
      C G A        A      | | | | |     A
    C       T C C G       G G G A G     C
    T       | | | |                 T T
    G       A G G C
      G T A        G     TGCTCATTAGAGCTC
                    C - G
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTGGGATAGCCTAGCCTGGTAAGGCGCAGGTCTGGAAAACCTGTGCTCATTAGAGCTCG
GGAGTTCAAATCTCCCTCCCAGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK