The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2040
Genome IDBA000011
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma volcanium GSS1 [BA000011]
Start position on genome 708186
End posion on genome 708114
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tagtttcatt
tRNA gene sequence
GCCCCGGTAGTGTAGTGGCCTATCATACAGGCCTGTCGAGCCTGTGACATGGGTTCAAAT
CCCGTCCGGGGCGcct
Downstream region at tRNA end position
tcattcgtaa
Secondary structure (Cloverleaf model)
>At2040	Asp	GTC
                   t      Gcct tcattcgtaa
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T G C C C     A
      T G A        A      | + | | |     A
    G       T G T G       A T G G G     C
    G         | | +                 T T
    C       T C A T
      C T A        A     TGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCCGGTAGTGTAGTGGCCTATCATACAGGCCTGTCGAGCCTGTGACATGGGTTCAAAT
CCCGTCCGGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK