The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2048
Genome IDBA000011
Search identical group
Phylum/ClassUnclassified
SpeciesThermoplasma volcanium GSS1 [BA000011]
Start position on genome 1241835
End posion on genome 1241762
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ttctaattat
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGTAGAGCATCTGGCTTTTAACCAGGTGGTCAGGGGTTCGAA
CCCCCTCGGGCCCGttc
Downstream region at tRNA end position
acgcgtggtg
Secondary structure (Cloverleaf model)
>At2048	Lys	TTT
                   t      Gttc acgcgtggtg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          C A
                    T     T C C C C     A
      C G A        A      | | | | |     G
    C       C T C G       A G G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        A     TGGTC
                    T + G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGTAGAGCATCTGGCTTTTAACCAGGTGGTCAGGGGTTCGAA
CCCCCTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK