The detailed information of tRNA gene sequence
[Important Notice]
tRNA genes in Archaeal genomes were obtained from
"SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology,
"6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution,
"25, 2709-2716, 2008".
| Sequence ID | >At2049 |
| Genome ID | BA000011 |
| Phylum/Class | Unclassified |
| Species | Thermoplasma volcanium GSS1 [BA000011] |
|
Start position on genome
|
1247190
|
|
End posion on genome
|
1247118
|
|
Amino Acid
|
Val
|
|
Anticodon
|
TAC
|
|
Upstream region at tRNA start position
|
cacctattaa
|
|
tRNA gene sequence
|
GGGCTCGTAGTCCAGTGGTTACGACGTCGCCCTTACAAGGCGGAGATCACCGGTTCGAAT CCGGTCGGGCCCAttc
|
|
Downstream region at tRNA end position
|
tacttgaaaa
|
| Secondary structure (Cloverleaf model) | >At2049 Val TAC
a Attc tacttgaaaa
G - C
G - C
G - C
C - G
T + G
C - G
G - C T A
T T G G C C A
T G A A | | | | | G
G C C T G A C C G G C
G | | | T T
T C G A C
T A G AGATC
T + G
C - G
G - C
C - G
C - G
C A
T A
T A C
|
| tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GGGCTCGTAGTCCAGTGGTTACGACGTCGCCCTTACAAGGCGGAGATCACCGGTTCGAAT CCGGTCGGGCCCA |
| Intron | |
| Final decision | ¡û |
| Comments | The tRNA gene was obtained from SPLITSdb. |
| Genome/Seq. Info. | [Ensembl] |
| SPLITSdb | [SPLITSdb] |
| Comment |
| --- |
| Input Comment |
BACK