The detailed information of tRNA gene sequence


Sequence ID>WENV170516873
Genome IDCEWC01023137
Search identical group
Phylum/Class[CEWC] marine metagenome genome assembly TARA_036_SRF_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx)
Species
Start position on genome 612
End posion on genome 542
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
tgccttttct
tRNA gene sequence
GCGAGTGTGGTGTAGCGGTAACATCCCATCCTTCCAAGTTGGTGTCACGAGTTCGATCCT
CGTCACTCGCTttc
Downstream region at tRNA end position
ggattgccga
Secondary structure (Cloverleaf model)
>WENV170516873	Gly	TCC
                   t      Tttc ggattgccga
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     T - A
                     G - C          C T
                    T     T G C T C     A
        G A        G      | | | | |     G
      C     T G T G       A C G A G     C
      G     | | | +                 T T
      G     A C A T
        T A        C     TGTC
                    C - G
                    C - G
                    A - T
                    T   T
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK