The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2093
Genome IDAM114193
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocella arvoryzae MRE50 [AM114193]
Start position on genome 969587
End posion on genome 969506
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
tttctcggaa
tRNA gene sequence
GCCGAGGTACTCTAACGGTAAGGGACTGGTCTCGAAAACCAGCGGTCGCAAGGCCTTAGG
AGTTCAAGTCTCCTCCTCGGCGctt
Downstream region at tRNA end position
aaaagttttt
Secondary structure (Cloverleaf model)
>At2093	Ser	CGA
                   a      Gctt aaaagttttt
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T G
                    T     T C C T C     A
        A A        A      | | | | |     A
      C     T C T C       A G G A G     C
      G     | | + |                 T T
      G     A G G G
        T A        A     CGGTCGCAAGGCCTT
                    C - G
                    T - A
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGGTACTCTAACGGTAAGGGACTGGTCTCGAAAACCAGCGGTCGCAAGGCCTTAGG
AGTTCAAGTCTCCTCCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK