The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2097
Genome IDAM114193
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocella arvoryzae MRE50 [AM114193]
Start position on genome 1566694
End posion on genome 1566623
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
ttgcaaaact
tRNA gene sequence
GGGCTCTTAACTCAGGGGTAGAGTGCTACGTTCGCAACGTAGATGCCGCGGGTTCAATTC
CCGCAGGGTCCActa
Downstream region at tRNA end position
agttttggga
Secondary structure (Cloverleaf model)
>At2097	Ala	CGC
                   t      Acta agttttggga
                     G - C
                     G - C
                     G + T
                     C - G
                     T + G
                     C - G
                     T - A          T T
                    T     C G C C C     A
        G A        A      | | | | |     A
      G     C T C A       G C G G G     C
      G     | | | |                 T T
      G     G A G T
        T A        G     ATGCC
                    C - G
                    T - A
                    A - T
                    C - G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCTTAACTCAGGGGTAGAGTGCTACGTTCGCAACGTAGATGCCGCGGGTTCAATTC
CCGCAGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK