The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2105
Genome IDAM114193
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocella arvoryzae MRE50 [AM114193]
Start position on genome 2611747
End posion on genome 2611674
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aaaagtaagc
tRNA gene sequence
GGGCCTGTGGTCTAGTTGGTTATGACATCGCCTTTACACGGCGGGGATCAGGGGTTCGAA
TCCCTTCGGGCCCActt
Downstream region at tRNA end position
catttttcct
Secondary structure (Cloverleaf model)
>At2105	Val	TAC
                   c      Actt catttttcct
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     G - C          T A
                    T     T T C C C     A
      T G A        G      | + | | |     G
    T       T C T G       A G G G G     C
    G         | | |                 T T
    G       T G A C
      T T A        A     GGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  T       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCTGTGGTCTAGTTGGTTATGACATCGCCTTTACACGGCGGGGATCAGGGGTTCGAA
TCCCTTCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK