The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2106
Genome IDAM114193
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocella arvoryzae MRE50 [AM114193]
Start position on genome 2852007
End posion on genome 2851935
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
aacgcaaaat
tRNA gene sequence
GCTCGGATAGTGTAGAGGCCTATCATGGGGCCCTGTCGAGGCTCCGACTCGGGTTCGAAT
CCCGATCCGAGCGctg
Downstream region at tRNA end position
gttttagaag
Secondary structure (Cloverleaf model)
>At2106	Asp	GTC
                   t      Gctg gttttagaag
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     A G C C C     A
      A G A        A      | | | | |     G
    G       T G T G       T C G G G     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    G - C
                    G + T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTCGGATAGTGTAGAGGCCTATCATGGGGCCCTGTCGAGGCTCCGACTCGGGTTCGAAT
CCCGATCCGAGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK