The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2116
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 259125
End posion on genome 259197
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
attagttcta
tRNA gene sequence
GCCCCGGTGGTGTAGCGGCCTAGCATGCGGGCCTGTCGAGCCCGCGACCCGGGTTCAAAT
CCCGGCCGGGGCGgtt
Downstream region at tRNA end position
ttttcattct
Secondary structure (Cloverleaf model)
>At2116	Asp	GTC
                   a      Ggtt ttttcattct
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     A
    G       T G T G       C C G G G     C
    G       + | | +                 T T
    C       G C A T
      C T A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCCGGTGGTGTAGCGGCCTAGCATGCGGGCCTGTCGAGCCCGCGACCCGGGTTCAAAT
CCCGGCCGGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK