The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2125
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 486338
End posion on genome 486422
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
tatttagatt
tRNA gene sequence
GCCGCCGTGCCCGAGCGGCCCAAGGGGGAGGGCTCGAGACCCTCTCCCCGCCAAGGGGGC
GGGGGTTCGAATCCCCCCGGCGGCGtta
Downstream region at tRNA end position
ttggataaac
Secondary structure (Cloverleaf model)
>At2125	Ser	CGA
                   t      Gtta ttggataaac
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     C C C C C     A
      C G A        G      | | | | |     G
    G       G C C C       G G G G G     C
    G         | | |                 T T
    C       A G G G
      C C A        G     TCCCCGCCAAGGGGGC
                    G - C
                    A - T
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGCCGTGCCCGAGCGGCCCAAGGGGGAGGGCTCGAGACCCTCTCCCCGCCAAGGGGGC
GGGGGTTCGAATCCCCCCGGCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK