The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2134
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 138297
End posion on genome 138224
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
acctaactct
tRNA gene sequence
GGGCCCGTAGCTCAGCCTGGAAGAGCGCCGGGCTTTTAACCCGGAAGTCGCGGGTTCGAA
TCCCGCCGGGCCCGcta
Downstream region at tRNA end position
tagttttaaa
Secondary structure (Cloverleaf model)
>At2134	Lys	TTT
                   t      Gcta tagttttaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C C C     A
      C G A        A      | | | | |     G
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G A A        G     AAGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCTGGAAGAGCGCCGGGCTTTTAACCCGGAAGTCGCGGGTTCGAA
TCCCGCCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK