The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2135
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 164240
End posion on genome 164169
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
attgccttct
tRNA gene sequence
GGGCCCGTAGTCTAGGGGTATGACGCCGCCCTTACAAGGCGGAGGTCCGGGGTTCGAATC
CCCGCGGGCCCAttt
Downstream region at tRNA end position
tgtgaagaag
Secondary structure (Cloverleaf model)
>At2135	Val	TAC
                   t      Attt tgtgaagaag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
        G A        A      | | | | |     G
      G     T C T G       C G G G G     C
      G       | | |                 T T
      G     T G A C
        T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGTCTAGGGGTATGACGCCGCCCTTACAAGGCGGAGGTCCGGGGTTCGAATC
CCCGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK