The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2138
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 253445
End posion on genome 253361
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
gtatgttttt
tRNA gene sequence
GCCGCCGTGCCCGAGCGGACCAAGGGGTTCGGCTGGAGACCGAATCCCCGATAAGGGGGC
GGGGGTTCGAATCCCCCCGGCGGCGtat
Downstream region at tRNA end position
ataaatcaat
Secondary structure (Cloverleaf model)
>At2138	Ser	GGA
                   t      Gtat ataaatcaat
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     C C C C C     A
      C G A        G      | | | | |     G
    G       G C C C       G G G G G     C
    G         | | |                 T T
    A       A G G G
      C C A        G     TCCCCGATAAGGGGGC
                    T - A
                    T - A
                    C - G
                    G - C
                    G - C
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGCCGTGCCCGAGCGGACCAAGGGGTTCGGCTGGAGACCGAATCCCCGATAAGGGGGC
GGGGGTTCGAATCCCCCCGGCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK