The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2208
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 734819
End posion on genome 734894
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
acccctcccc
tRNA gene sequence
GGGCCCGTAGCTCAGCTGGAAGAGCGCCGCCCTCGCAAGGCGGAGGTCCCGGGTTCAAAT
CCCGGCGGGTCCACCA
Downstream region at tRNA end position
cttccaaaag
Secondary structure (Cloverleaf model)
>At2208	Ala	CGC
                   c      ACCA cttccaaaag
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    T       C T C G       C C G G G     C
    G       | | | |                 T T
    G       G A G C
      A A          G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCTGGAAGAGCGCCGCCCTCGCAAGGCGGAGGTCCCGGGTTCAAAT
CCCGGCGGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK