The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2217
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 1268214
End posion on genome 1268289
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
cagaacccgg
tRNA gene sequence
AGCCGGGTCGTCTAGCGGCCAAGGATGCGGGGCTTTGGCCCCCGTGACCGGGGTTCGAAT
CCCCGCCCGGCTACCA
Downstream region at tRNA end position
cttatccatt
Secondary structure (Cloverleaf model)
>At2217	Gln	TTG
                   g      ACCA cttatccatt
                     A - T
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T A
                    T     G C C C C     A
      C G A        C      | | | | |     G
    G       T C T G       C G G G G     C
    G       + | | +                 T T
    C       G G A T
      C A A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       C
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCGGGTCGTCTAGCGGCCAAGGATGCGGGGCTTTGGCCCCCGTGACCGGGGTTCGAAT
CCCCGCCCGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK