The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2226
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 1192213
End posion on genome 1192121
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
cggaggcttc
tRNA gene sequence
GGGGCCGTCGTCTAGCCCGGAAGGACGCCGCCCTTACGAGGCGGTAGTCCGGGGTTCAAA
TCCCCGCGGCCCCACCA
Downstream region at tRNA end position
cacgaaattt
Secondary structure (Cloverleaf model)
>At2226	Val	TAC
                   c      ACCA cacgaaattt
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
      C G A        C      | | | | |     A
    C       T C T G       C G G G G     C
    C       + | | |                 T T
    G       G G A C
      G A A        G     TAGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G *
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGCCGTCGTCTAGCCCGGAAGGACGCCGCCCTTACGagccctgagctgggagAGGCGG
TAGTCCGGGGTTCAAATCCCCGCGGCCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK