The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2237
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 468256
End posion on genome 468180
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ccccacgccc
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGAAGAGCGCCGGGCTTTTAACCCGGTGGTCCCGGGTTCAAA
TCCCGGCGGGCCCGCCA
Downstream region at tRNA end position
cacgcggaag
Secondary structure (Cloverleaf model)
>At2237	Lys	TTT
                   c      GCCA cacgcggaag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    A       | | | |                 T T
    G       G A G C
      G A A        G     TGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGAAGAGCGCCGGGCTTTTAACCCGGTGGTCCCGGGTTCAAA
TCCCGGCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK