The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2242
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 153641
End posion on genome 153564
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
cgcgggaagt
tRNA gene sequence
GCCGCGGTAGTATAGCCTGGCCCAGTATGCGGGCCTGTCAAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGCGGCGCCA
Downstream region at tRNA end position
cacttccctc
Secondary structure (Cloverleaf model)
>At2242	Asp	GTC
                   t      GCCA cacttccctc
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T A T G       C C G G G     C
  G         + | | +                 T T
  G         G T A T
    C C C A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGCGGTAGTATAGCCTGGCCCAGTATGCGGGCCTGTCAAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK