The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2243
Genome IDCP000816
Search identical group
Phylum/ClassThermoproteota
SpeciesIgnicoccus hospitalis KIN4/I [CP000816]
Start position on genome 62894
End posion on genome 62806
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
accctagctc
tRNA gene sequence
GCCGGGGTGCCCGAGCGGCCCAAGGGGGTGGCCTGGAGAGCCACTCCCCCTGATGGGGGG
CGCGGGTTCGAATCCCGCCCCCGGCGCCA
Downstream region at tRNA end position
gaccttaaaa
Secondary structure (Cloverleaf model)
>At2243	Ser	GGA
                   c      GCCA gaccttaaaa
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        G      | | | | |     G
    G       G C C C       G C G G G     C
    G         | | |                 T T
    C       A G G G
      C C A        G     TCCCCCTGATGGGGGGC
                    G - C
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGCCCGAGCGGCCCAAGGGGGTGGCCTGGAGAGCCACTCCCCCTGATGGGGGG
CGCGGGTTCGAATCCCGCCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK