| Sequence ID | >WENV170539872 |
| Genome ID | CWGP01000089 |
| Phylum/Class | [CWGP] human gut metagenome; ENVO:feces |
| Species | |
| Start position on genome | 71 |
| End posion on genome | 161 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
cttttaggcT |
| tRNA gene sequence |
GGAGAGTTGTCCGAGAGGCCGAAGGAGCATGATTGGAAATCATGTAGATGGCTACCGCTG |
| Downstream region at tRNA end position |
taatcttggt |
| Secondary structure (Cloverleaf model) | >WENV170539872 Ser GGA
T GTta taatcttggt
G - C
G - C
A - T
G - C
A - T
G - C
T - A T A
T T T C C C A
A G A G | | | | | G
G G C C T A A G G G C
G | | | T T
C A G G A
C G A G TAGATGGCTACCGCTGTCTC
C - G
A - T
T - A
G - C
A - T
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |