The detailed information of tRNA gene sequence


Sequence ID>WENV170549979
Genome IDCXVM01000532
Search identical group
Phylum/Class[CXVM] Human gut metagenome genome assembly, contig: mF6_contig003426.; ENVO:feces
Species
Start position on genome 954
End posion on genome 1028
Amino Acid Arg
Anticodon CCG
Upstream region at tRNA start position
gtctgtactT
tRNA gene sequence
GCGTCCTTAGTGTAGTGGATATCACGTAAGATTCCGGTTCTTGAGACGGGGGTTCGATTC
CCTCAGGACGCGTCt
Downstream region at tRNA end position
attgctatct
Secondary structure (Cloverleaf model)
>WENV170549979	Arg	CCG
                   T      GTCt attgctatct
                     G - C
                     C - G
                     G - C
                     T - A
                     C - G
                     C - G
                     T - A          T T
                    T     C T C C C     A
      T G A        A      | + | | |     G
    G       T G T G       G G G G G     C
    G         | | |                 T T
    A       T C A C
      T A          G     AGAC
                    T + G
                    A - T
                    A - T
                    G - C
                    A - T
                  T       T
                  T       G
                    C C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK