| Sequence ID | >WENV170552458 |
| Genome ID | CXWK01000096 |
| Phylum/Class | [CXWK] wastewater metagenome; activated sludge |
| Species | |
| Start position on genome | 37093 |
| End posion on genome | 37018 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
caccgcttac |
| tRNA gene sequence |
GCGGACGTGGCTCAGCTGGTAGAGCATCACCTTGCCAAGGTGAGGGTCGCGGGTTCGAAT |
| Downstream region at tRNA end position |
acaaagacct |
| Secondary structure (Cloverleaf model) | >WENV170552458 Gly GCC
c TCCA acaaagacct
G - C
C - G
G - C
G - C
A - T
C - G
G - C T A
T T G C C C A
C G A G + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A A GGGTC
T - A
C - G
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |