| Sequence ID | >WENV170564464 |
| Genome ID | CZKP01000046 |
| Phylum/Class | [CZKP] soil metagenome genome assembly CiPEHR-AK-2010-FBin.4, contig:; soil |
| Species | |
| Start position on genome | 17722 |
| End posion on genome | 17797 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
ttataacaag |
| tRNA gene sequence |
CGGGGTGTAGCGCAGCCCGGTTAGCGCGCTTCGTTCGGGACGAAGAGGTCGAGAGTTCGA |
| Downstream region at tRNA end position |
ttaactatgg |
| Secondary structure (Cloverleaf model) | >WENV170564464 Pro CGG
g ACtt ttaactatgg
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C T C T C A
C C G A A | | | | | G
C C G C G G A G A G C
G | | | | T T
G G C G C
T T A G AGGTC
C - G
T - A
T - A
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |