| Sequence ID | >WENV170572698 |
| Genome ID | FLOH01001174 |
| Phylum/Class | [FLOH] marine metagenome; water |
| Species | |
| Start position on genome | 30623 |
| End posion on genome | 30710 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
gctaaaaact |
| tRNA gene sequence |
GGAGAGTTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGTAACGTATC |
| Downstream region at tRNA end position |
ctacgctata |
| Secondary structure (Cloverleaf model) | >WENV170572698 Ser GGA
t GCCA ctacgctata
G - C
G - C
A - T
G - C
A - T
G - C
T - A T A
T C T C C C A
T G A G | | | | | G
G G C C T G A G G G C
G | | | T T
C A G G A
T G A G TATACGGTAACGTATC
C - G
A - T
C - G
G + T
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |