| Sequence ID | >WENV170579600 |
| Genome ID | FUFK010039945 |
| Phylum/Class | [FUFK] metagenome; unknown |
| Species | |
| Start position on genome | 5763 |
| End posion on genome | 5854 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
tgcgacatgc |
| tRNA gene sequence |
GGAGACGTGGGTGAGTGGCTGAAACCAGCTCCCTGCTAAGGAGCCATACCTGGTAACGGG |
| Downstream region at tRNA end position |
ntggcttctc |
| Secondary structure (Cloverleaf model) | >WENV170579600 Ser GCT
c GCCA ntggcttctc
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T C T C C C A
T G A G | | | | | G
G G T G G G A G G G C
G | | | T T
C A A C C
T G A A CATACCTGGTAACGGGTATC
G - C
C - G
T - A
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |