The detailed information of tRNA gene sequence


Sequence ID>WENV170598502
Genome IDFUWD010037560
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 232
End posion on genome 156
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
atttttttgc
tRNA gene sequence
GGGGTCGTAGTTAAGTTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCAGGGGTTCGAG
TCCCCTCGACCCCGCCA
Downstream region at tRNA end position
taaatattaa
Secondary structure (Cloverleaf model)
>WENV170598502	Asp	GTC
                   c      GCCA taaatattaa
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     G - C          T G
                    T     T C C C C     A
      T G A        A      | | | | |     G
    T       A T T G       A G G G G     C
    G       | | | |                 T T
    G       T A A C
      T T A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK