The detailed information of tRNA gene sequence


Sequence ID>WENV170607841
Genome IDFUWD010860116
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 391
End posion on genome 302
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
cttttgcagc
tRNA gene sequence
GGAGAAATGGCAGAGTGGTCGAATGCGGCGGTCTTGAAAACCGTTGTCCGTTTACTCGGA
CCGGGGGTTCGAATCCCTCTTTCTCCGCAA
Downstream region at tRNA end position
agtacaaaca
Secondary structure (Cloverleaf model)
>WENV170607841	Ser	TGA
                   c      GCAA agtacaaaca
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     A - T
                     A - T          T A
                    T     C T C C C     A
      T G A        G      | + | | |     G
    G       G A C G       G G G G G     C
    G         | | |                 T T
    T       A T G C
      C G A        G     TGTCCGTTTACTCGGACC
                    G + T
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK