The detailed information of tRNA gene sequence


Sequence ID>WENV170611834
Genome IDFUWD012413734
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 156
End posion on genome 82
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tccaccatat
tRNA gene sequence
AGTAGCGTAGCACAATGGAAGTGCGACTGTCTCATTAACAGTAGGTTGTATGTTCGAATC
ATACCGTTACTACCA
Downstream region at tRNA end position
tgcaggatgg
Secondary structure (Cloverleaf model)
>WENV170611834	Met	CAT
                   t      ACCA tgcaggatgg
                     A - T
                     G - C
                     T - A
                     A - T
                     G + T
                     C - G
                     G - C          T A
                    T     C A T A C     A
        A A        A      | | | | |     G
      T     C A C G       G T A T G     C
      G     | | | |                 T T
      G     G T G C
        A A        G     AGGTT
                    A - T
                    C - G
                    T - A
                    G - C
                    T - A
                  C       A
                  T       T
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK