The detailed information of tRNA gene sequence


Sequence ID>WENV170611869
Genome IDFUWD012425519
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 175
End posion on genome 87
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
ttttaactaa
tRNA gene sequence
GGCGGGGTGTCAGAGTGGACGATTGAGATGGTTTCGAAAACCATTGTTCCTTTTTGGAAC
CGGAGGTTCGAATCCTCCCCCCGCCGCCT
Downstream region at tRNA end position
ttaagtgacc
Secondary structure (Cloverleaf model)
>WENV170611869	Ser	CGA
                   a      GCCT ttaagtgacc
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C C T C C     A
      T G A        G      | | | | |     G
    G       G A C T       G G A G G     C
    G       + | | |                 T T
    A       T T G A
      C G A        G     TGTTCCTTTTTGGAACC
                    A - T
                    T - A
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK