The detailed information of tRNA gene sequence


Sequence ID>WENV170611889
Genome IDFUWD012430299
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 127
End posion on genome 199
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
atcccgctcc
tRNA gene sequence
GCCGGGGTAGCTTAAATGGTAAAGCAATCGCTTCGTAAGCGATAGACTGGAGGTTCAAGT
CCTCTCCTCGGCTtag
Downstream region at tRNA end position
atatttagaa
Secondary structure (Cloverleaf model)
>WENV170611889	Thr	CGT
                   c      Ttag atatttagaa
                     G - C
                     C - G
                     C - G
                     G - C
                     G + T
                     G - C
                     G - C          T G
                    T     T C T C C     A
      A A A        A      + | | | |     A
    T       T T C G       G G A G G     C
    G       | | | |                 T T
    G       A A G C
      T A          A     AGACT
                    A - T
                    T - A
                    C - G
                    G - C
                    C - G
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK