The detailed information of tRNA gene sequence


Sequence ID>WENV170611902
Genome IDFUWD012434005
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 67
End posion on genome 160
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tacatcatta
tRNA gene sequence
GGAGAGGTGCTTGAGTGGCTGAAAAGGACCGCCTGCTAAGCGGTTGGGCGGGTTTAACCC
CGCCTCGAGGGTTCGAATCCCTCCCTCTCCGCCA
Downstream region at tRNA end position
aatcaaacca
Secondary structure (Cloverleaf model)
>WENV170611902	Ser	GCT
                   a      GCCA aatcaaacca
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T T C       G A G G G     C
    G         | | |                 T T
    C       A A A G
      T G A        G     TGGGCGGGTTTAACCCCGCCTC
                    A - T
                    C - G
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK