The detailed information of tRNA gene sequence


Sequence ID>WENV170616519
Genome IDFUWD012889872
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 133
End posion on genome 207
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
atgaatttat
tRNA gene sequence
AGTCCCTTAGCTCAGTTGGTTAGAGCGCTACACTGATAATGTAGAGGTCCGCAGTTCAAA
TCTGCGAGGGACTACag
Downstream region at tRNA end position
ttataagggg
Secondary structure (Cloverleaf model)
>WENV170616519	Ile	GAT
                   t      ACag ttataagggg
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     T - A          T A
                    T     G C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       C G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK