The detailed information of tRNA gene sequence


Sequence ID>WENV170619953
Genome IDFUWD013023525
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 197
End posion on genome 272
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
atttttgtcg
tRNA gene sequence
GCCCACGTAGCTCAGTTGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCAATC
CTGGTCGTGGGCTCCA
Downstream region at tRNA end position
ttttggtgaa
Secondary structure (Cloverleaf model)
>WENV170619953	Thr	GGT
                   g      TCCA ttttggtgaa
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     C - G
                     G - C          C T
                    T     T G G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK